From 9eed9ae2d73cdb16a3f072a9a66b6bda936fb94e Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 12:01:02 -0800
Subject: [PATCH 01/32] some bulk loading/cleaning tests

---
 tests/test-data/valid-read-testing.fq | 32 ++++++++++++++++++++++++
 tests/test_read_parsers.py            | 35 ++++++++++++++++++++++++++-
 2 files changed, 66 insertions(+), 1 deletion(-)
 create mode 100644 tests/test-data/valid-read-testing.fq

diff --git a/tests/test-data/valid-read-testing.fq b/tests/test-data/valid-read-testing.fq
new file mode 100644
index 0000000000..e28921cddf
--- /dev/null
+++ b/tests/test-data/valid-read-testing.fq
@@ -0,0 +1,32 @@
+@895:1:1:1246:14654 1:N:0:NNNNN
+CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT
++
+][aaX__aa[`ZUZ[NONNFNNNNNO_____^RQ_
+@895:1:1:1248:9583 1:N:0:NNNNN
+ACTGGGCGTAGACGGTGTCCTCATCGGCACCAGC
++
+\UJUWSSV[JQQWNP]]SZ]ZWU^]ZX][^TXR`
+@895:1:1:1252:19493 1:N:0:NNNNN
+CCGGCGTGGTTGGTGAGGTCACTGAGCTTCATGTC
++
+OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
+@895:1:1:1255:18861 1:N:0:NNNNN
+ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
++
+bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
+@lowercase_to_uppercase
+caggcgcccaccaccgtgccctccaacctgatggt
++
+][aaX__aa[`ZUZ[NONNFNNNNNO_____^RQ_
+@n_in_read
+ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC
++
+\UJUWSSV[JQQWNP]]SZ]ZWU^]ZX][^TXR`
+@895:1:1:1252:19493 1:N:0:NNNNN
+CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC
++
+OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
+@895:1:1:1255:18861 1:N:0:NNNNN
+ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
++
+bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 22cdf32ad7..8e01235131 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -38,7 +38,7 @@
 from __future__ import print_function
 from __future__ import absolute_import
 from khmer import Read
-from khmer import ReadParser
+from khmer import ReadParser, Counttable, Nodegraph
 from screed import Record
 from . import khmer_tst_utils as utils
 import pytest
@@ -483,5 +483,38 @@ def test_clean_seq():
         clean = read.sequence.upper().replace("N", "A")
         assert clean == read.cleaned_seq
 
+
+def test_read_cleaning_consume_seqfile():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    x.consume_seqfile(infile)
+
+    # the relevant read will automatically get uppercased => abundance of 2
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 2
+
+    # the 2nd read with this k-mer in it has an N in it.
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 1               # this should be 2 in the future
+
+    # the 2nd read with this k-mer in it has a Z in it
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 1               # this should be 2 in the future
+
+
+def test_read_cleaning_abundance_distribution():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    y = Nodegraph(15, int(1e6), 4)
+
+    x.consume_seqfile(infile)
+
+    dist = x.abundance_distribution(infile, y)
+    assert dist[1] == 41
+    assert dist[2] == 42
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From c0c5d2cb77639a7dc163618ffdb910f36afe670d Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 12:11:51 -0800
Subject: [PATCH 02/32] nail down existing ACTGN behavior

---
 tests/test_read_parsers.py | 41 ++++++++++++++++++++++++++++++++++++++
 1 file changed, 41 insertions(+)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 8e01235131..8d2c01022f 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -503,6 +503,47 @@ def test_read_cleaning_consume_seqfile():
     assert x.get(kmer) == 1               # this should be 2 in the future
 
 
+def test_read_cleaning_consume_read_by_read():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.sequence)          # consume raw sequence
+
+    # the relevant read will be entirely ignored
+    # (b/c ReadParser does not uppercase)
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 1
+
+    # the 2nd read with this k-mer in it has an N in it; 'consume' will ignore.
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 2
+
+    # the 2nd read with this k-mer in it has a Z in it; 'consume' will ignore.
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 2
+
+
+def test_read_cleaning_consume_read_by_read_cleaned_seq():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    # the relevant read will be cleaned & loaded
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 2
+
+    # this k-mer will be correctly loaded
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 2
+
+    # this k-mer will be correctly loaded
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 2
+
+
 def test_read_cleaning_abundance_distribution():
     infile = utils.get_test_data('valid-read-testing.fq')
 

From e77f1e16b70a142a8099bfb92c895abbdb9a5cab Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 13:56:35 -0800
Subject: [PATCH 03/32] add tests for various trim functions w/bad DNA input

---
 tests/test_read_parsers.py | 59 ++++++++++++++++++++++++++++++++++++++
 1 file changed, 59 insertions(+)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 8d2c01022f..6fe0137cbe 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -557,5 +557,64 @@ def test_read_cleaning_abundance_distribution():
     assert dist[2] == 42
 
 
+def test_read_cleaning_trim_functions_lowercase():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "caggcgcccaccaccgtgccctccaacctgatggt"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 35                    # in future, should be '0'
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 35                    # in future, should be '0'
+
+    posns = x.find_spectral_error_positions(s, 1)
+    assert posns == []                    # in future, should do same
+
+
+def test_read_cleaning_trim_functions_N():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 0                     # in future, should be ??
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 0                     # in future, should be ??
+
+    with pytest.raises(ValueError):
+        posns = x.find_spectral_error_positions(s, 1)
+    # assert posns == []                    # in future, should return []
+
+
+def test_read_cleaning_trim_functions_bad_dna():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 0                     # in future, should be ??
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 0                     # in future, should be ??
+
+    with pytest.raises(ValueError):
+        posns = x.find_spectral_error_positions(s, 1)
+    # assert posns == []                    # in future, should return []
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 33a77029cd414e14d39389ccc11168426399ac86 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 14:07:54 -0800
Subject: [PATCH 04/32] fixed

---
 tests/test_read_parsers.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 6fe0137cbe..e51cec5ced 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -570,7 +570,7 @@ def test_read_cleaning_trim_functions_lowercase():
     assert where == 35                    # in future, should be '0'
 
     _, where = x.trim_below_abundance(s, 2)
-    assert where == 35                    # in future, should be '0'
+    assert where == 35                    # in future, should be ?? @CTB
 
     posns = x.find_spectral_error_positions(s, 1)
     assert posns == []                    # in future, should do same
@@ -613,7 +613,7 @@ def test_read_cleaning_trim_functions_bad_dna():
 
     with pytest.raises(ValueError):
         posns = x.find_spectral_error_positions(s, 1)
-    # assert posns == []                    # in future, should return []
+    # assert posns == []                    # in future, should return [11]
 
 
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:

From adfe3b989037d1819c3774fd972cea7d58476694 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 18:34:55 -0800
Subject: [PATCH 05/32] tset current output_partitions behavior in subset.cc

---
 tests/test-data/valid-read-testing.fq |  2 +-
 tests/test_read_parsers.py            | 38 +++++++++++++++++++++++++++
 2 files changed, 39 insertions(+), 1 deletion(-)

diff --git a/tests/test-data/valid-read-testing.fq b/tests/test-data/valid-read-testing.fq
index e28921cddf..e52c058709 100644
--- a/tests/test-data/valid-read-testing.fq
+++ b/tests/test-data/valid-read-testing.fq
@@ -22,7 +22,7 @@ caggcgcccaccaccgtgccctccaacctgatggt
 ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC
 +
 \UJUWSSV[JQQWNP]]SZ]ZWU^]ZX][^TXR`
-@895:1:1:1252:19493 1:N:0:NNNNN
+@zy_in_read
 CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC
 +
 OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index e51cec5ced..c1a4b42019 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -616,5 +616,43 @@ def test_read_cleaning_trim_functions_bad_dna():
     # assert posns == []                    # in future, should return [11]
 
 
+def test_read_cleaning_output_partitions():
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Nodegraph(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    kmer = 'caggcgcc'.upper()
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 1)
+
+    kmer = 'ACTGGGCG'
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 2)
+    
+    kmer = 'CCGGCGTG'
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 3)
+    
+    x.output_partitions(infile, savepath)
+
+    read_names = [ read.name for read in ReadParser(savepath) ]
+    print(read_names)
+    assert len(read_names) == 4
+
+    assert '895:1:1:1246:14654 1:N:0:NNNNN\t1' in read_names
+    assert '895:1:1:1248:9583 1:N:0:NNNNN\t2' in read_names
+    assert '895:1:1:1252:19493 1:N:0:NNNNN\t3' in read_names
+
+    assert 'lowercase_to_uppercase\t1' in read_names
+
+    assert 'n_in_read\t2' not in read_names
+    assert 'zy_in_read\t3' not in read_names
+
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 5adf7bf42040688e5ddec35ef9dd7489bcd53396 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Feb 2017 19:04:32 -0800
Subject: [PATCH 06/32] add test for trim_on_stoptags

---
 tests/test_read_parsers.py | 28 ++++++++++++++++++++++++++++
 1 file changed, 28 insertions(+)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index c1a4b42019..5d2f1c0896 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -653,6 +653,34 @@ def test_read_cleaning_output_partitions():
     assert 'zy_in_read\t3' not in read_names
 
 
+def test_read_cleaning_trim_on_stoptags():
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Nodegraph(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    # add this as a stop tag
+    kmer = 'caggcgcc'.upper()
+    x.add_stop_tag(kmer)
+
+    kmer = 'ACTGGGCG'
+    x.add_stop_tag(kmer)
+
+    kmer = 'CCGGCGTG'
+    x.add_stop_tag(kmer)
+
+    _, pos = x.trim_on_stoptags('caggcgcccaccaccgtgccctccaacctgatggt')
+    assert pos == 6                       # should be ?? in future
+
+    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
+    assert pos == 0                       # should be 6 in future
+
+    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
+    assert pos == 0                       # should be 6 in future
+
 
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From fe487879c47c4c96d4f368363c735d0f0ac825dd Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 20:45:33 -0800
Subject: [PATCH 07/32] fix comments to be clearer

---
 tests/test_read_parsers.py | 6 ++++--
 1 file changed, 4 insertions(+), 2 deletions(-)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 5d2f1c0896..10332a59a4 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -515,11 +515,13 @@ def test_read_cleaning_consume_read_by_read():
     kmer = "caggcgcccaccacc".upper()
     assert x.get(kmer) == 1
 
-    # the 2nd read with this k-mer in it has an N in it; 'consume' will ignore.
+    # consume will ignore the invalid base in 2nd read containing this k-mer,
+    # so the k-mer will have an abundance of 2.
     kmer = "CCTCATCGGCACCAG"
     assert x.get(kmer) == 2
 
-    # the 2nd read with this k-mer in it has a Z in it; 'consume' will ignore.
+    # consume will ignore the invalid base in 2nd read containing this k-mer,
+    # so the k-mer will have an abundance of 2.
     kmer = "ACTGAGCTTCATGTC"
     assert x.get(kmer) == 2
 

From 756454e979c2564cb13ee242ed720865b707ec83 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 20:46:25 -0800
Subject: [PATCH 08/32] fix pep8

---
 tests/test_read_parsers.py | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 10332a59a4..369be37576 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -634,14 +634,14 @@ def test_read_cleaning_output_partitions():
     kmer = 'ACTGGGCG'
     x.add_tag(kmer)
     x.set_partition_id(kmer, 2)
-    
+
     kmer = 'CCGGCGTG'
     x.add_tag(kmer)
     x.set_partition_id(kmer, 3)
-    
+
     x.output_partitions(infile, savepath)
 
-    read_names = [ read.name for read in ReadParser(savepath) ]
+    read_names = [read.name for read in ReadParser(savepath)]
     print(read_names)
     assert len(read_names) == 4
 

From 2db818063a48970b7c280fd93e6b5effc373de7d Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 21:04:12 -0800
Subject: [PATCH 09/32] moved read validity foo over to
 test_sequence_validation.py

---
 tests/test_read_parsers.py        | 200 ------------------------
 tests/test_sequence_validation.py | 248 ++++++++++++++++++++++++++++++
 2 files changed, 248 insertions(+), 200 deletions(-)
 create mode 100644 tests/test_sequence_validation.py

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 369be37576..a919bb5a00 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -484,205 +484,5 @@ def test_clean_seq():
         assert clean == read.cleaned_seq
 
 
-def test_read_cleaning_consume_seqfile():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    x = Counttable(15, int(1e6), 4)
-    x.consume_seqfile(infile)
-
-    # the relevant read will automatically get uppercased => abundance of 2
-    kmer = "caggcgcccaccacc".upper()
-    assert x.get(kmer) == 2
-
-    # the 2nd read with this k-mer in it has an N in it.
-    kmer = "CCTCATCGGCACCAG"
-    assert x.get(kmer) == 1               # this should be 2 in the future
-
-    # the 2nd read with this k-mer in it has a Z in it
-    kmer = "ACTGAGCTTCATGTC"
-    assert x.get(kmer) == 1               # this should be 2 in the future
-
-
-def test_read_cleaning_consume_read_by_read():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    x = Counttable(15, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.sequence)          # consume raw sequence
-
-    # the relevant read will be entirely ignored
-    # (b/c ReadParser does not uppercase)
-    kmer = "caggcgcccaccacc".upper()
-    assert x.get(kmer) == 1
-
-    # consume will ignore the invalid base in 2nd read containing this k-mer,
-    # so the k-mer will have an abundance of 2.
-    kmer = "CCTCATCGGCACCAG"
-    assert x.get(kmer) == 2
-
-    # consume will ignore the invalid base in 2nd read containing this k-mer,
-    # so the k-mer will have an abundance of 2.
-    kmer = "ACTGAGCTTCATGTC"
-    assert x.get(kmer) == 2
-
-
-def test_read_cleaning_consume_read_by_read_cleaned_seq():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    x = Counttable(15, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    # the relevant read will be cleaned & loaded
-    kmer = "caggcgcccaccacc".upper()
-    assert x.get(kmer) == 2
-
-    # this k-mer will be correctly loaded
-    kmer = "CCTCATCGGCACCAG"
-    assert x.get(kmer) == 2
-
-    # this k-mer will be correctly loaded
-    kmer = "ACTGAGCTTCATGTC"
-    assert x.get(kmer) == 2
-
-
-def test_read_cleaning_abundance_distribution():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    x = Counttable(15, int(1e6), 4)
-    y = Nodegraph(15, int(1e6), 4)
-
-    x.consume_seqfile(infile)
-
-    dist = x.abundance_distribution(infile, y)
-    assert dist[1] == 41
-    assert dist[2] == 42
-
-
-def test_read_cleaning_trim_functions_lowercase():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    s = "caggcgcccaccaccgtgccctccaacctgatggt"
-    _, where = x.trim_on_abundance(s, 1)
-    assert where == 35                    # in future, should be '0'
-
-    _, where = x.trim_below_abundance(s, 2)
-    assert where == 35                    # in future, should be ?? @CTB
-
-    posns = x.find_spectral_error_positions(s, 1)
-    assert posns == []                    # in future, should do same
-
-
-def test_read_cleaning_trim_functions_N():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    s = "ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC"
-    _, where = x.trim_on_abundance(s, 1)
-    assert where == 0                     # in future, should be ??
-
-    _, where = x.trim_below_abundance(s, 2)
-    assert where == 0                     # in future, should be ??
-
-    with pytest.raises(ValueError):
-        posns = x.find_spectral_error_positions(s, 1)
-    # assert posns == []                    # in future, should return []
-
-
-def test_read_cleaning_trim_functions_bad_dna():
-    infile = utils.get_test_data('valid-read-testing.fq')
-
-    # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    s = "CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC"
-    _, where = x.trim_on_abundance(s, 1)
-    assert where == 0                     # in future, should be ??
-
-    _, where = x.trim_below_abundance(s, 2)
-    assert where == 0                     # in future, should be ??
-
-    with pytest.raises(ValueError):
-        posns = x.find_spectral_error_positions(s, 1)
-    # assert posns == []                    # in future, should return [11]
-
-
-def test_read_cleaning_output_partitions():
-    infile = utils.get_test_data('valid-read-testing.fq')
-    savepath = utils.get_temp_filename('foo')
-
-    # read this in using "approved good" behavior w/cleaned_seq
-    x = Nodegraph(8, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    kmer = 'caggcgcc'.upper()
-    x.add_tag(kmer)
-    x.set_partition_id(kmer, 1)
-
-    kmer = 'ACTGGGCG'
-    x.add_tag(kmer)
-    x.set_partition_id(kmer, 2)
-
-    kmer = 'CCGGCGTG'
-    x.add_tag(kmer)
-    x.set_partition_id(kmer, 3)
-
-    x.output_partitions(infile, savepath)
-
-    read_names = [read.name for read in ReadParser(savepath)]
-    print(read_names)
-    assert len(read_names) == 4
-
-    assert '895:1:1:1246:14654 1:N:0:NNNNN\t1' in read_names
-    assert '895:1:1:1248:9583 1:N:0:NNNNN\t2' in read_names
-    assert '895:1:1:1252:19493 1:N:0:NNNNN\t3' in read_names
-
-    assert 'lowercase_to_uppercase\t1' in read_names
-
-    assert 'n_in_read\t2' not in read_names
-    assert 'zy_in_read\t3' not in read_names
-
-
-def test_read_cleaning_trim_on_stoptags():
-    infile = utils.get_test_data('valid-read-testing.fq')
-    savepath = utils.get_temp_filename('foo')
-
-    # read this in using "approved good" behavior w/cleaned_seq
-    x = Nodegraph(8, int(1e6), 4)
-    for read in ReadParser(infile):
-        x.consume(read.cleaned_seq)       # consume cleaned_seq
-
-    # add this as a stop tag
-    kmer = 'caggcgcc'.upper()
-    x.add_stop_tag(kmer)
-
-    kmer = 'ACTGGGCG'
-    x.add_stop_tag(kmer)
-
-    kmer = 'CCGGCGTG'
-    x.add_stop_tag(kmer)
-
-    _, pos = x.trim_on_stoptags('caggcgcccaccaccgtgccctccaacctgatggt')
-    assert pos == 6                       # should be ?? in future
-
-    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
-    assert pos == 0                       # should be 6 in future
-
-    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
-    assert pos == 0                       # should be 6 in future
-
-
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:
diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
new file mode 100644
index 0000000000..8c062613a6
--- /dev/null
+++ b/tests/test_sequence_validation.py
@@ -0,0 +1,248 @@
+# This file is part of khmer, https://github.com/dib-lab/khmer/, and is
+# Copyright (C) 2013-2015, Michigan State University.
+# Copyright (C) 2015-2016, The Regents of the University of California.
+#
+# Redistribution and use in source and binary forms, with or without
+# modification, are permitted provided that the following conditions are
+# met:
+#
+#     * Redistributions of source code must retain the above copyright
+#       notice, this list of conditions and the following disclaimer.
+#
+#     * Redistributions in binary form must reproduce the above
+#       copyright notice, this list of conditions and the following
+#       disclaimer in the documentation and/or other materials provided
+#       with the distribution.
+#
+#     * Neither the name of the Michigan State University nor the names
+#       of its contributors may be used to endorse or promote products
+#       derived from this software without specific prior written
+#       permission.
+#
+# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
+# "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
+# LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+# A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
+# HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
+# SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
+# LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
+# DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
+# THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
+# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
+# OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
+#
+# Contact: khmer-project@idyll.org
+# pylint: disable=missing-docstring,invalid-name
+
+# Tests for the ReadParser and Read classes.
+from __future__ import print_function
+from __future__ import absolute_import
+from khmer import ReadParser, Counttable, Nodegraph
+from screed import Record
+from . import khmer_tst_utils as utils
+import pytest
+from functools import reduce  # pylint: disable=redefined-builtin
+
+
+def test_read_cleaning_consume_seqfile():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    x.consume_seqfile(infile)
+
+    # the relevant read will automatically get uppercased => abundance of 2
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 2
+
+    # the 2nd read with this k-mer in it has an N in it.
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 1               # this should be 2 in the future
+
+    # the 2nd read with this k-mer in it has a Z in it
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 1               # this should be 2 in the future
+
+
+def test_read_cleaning_consume_read_by_read():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.sequence)          # consume raw sequence
+
+    # the relevant read will be entirely ignored
+    # (b/c ReadParser does not uppercase)
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 1
+
+    # consume will ignore the invalid base in 2nd read containing this k-mer,
+    # so the k-mer will have an abundance of 2.
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 2
+
+    # consume will ignore the invalid base in 2nd read containing this k-mer,
+    # so the k-mer will have an abundance of 2.
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 2
+
+
+def test_read_cleaning_consume_read_by_read_cleaned_seq():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    # the relevant read will be cleaned & loaded
+    kmer = "caggcgcccaccacc".upper()
+    assert x.get(kmer) == 2
+
+    # this k-mer will be correctly loaded
+    kmer = "CCTCATCGGCACCAG"
+    assert x.get(kmer) == 2
+
+    # this k-mer will be correctly loaded
+    kmer = "ACTGAGCTTCATGTC"
+    assert x.get(kmer) == 2
+
+
+def test_read_cleaning_abundance_distribution():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    x = Counttable(15, int(1e6), 4)
+    y = Nodegraph(15, int(1e6), 4)
+
+    x.consume_seqfile(infile)
+
+    dist = x.abundance_distribution(infile, y)
+    assert dist[1] == 41
+    assert dist[2] == 42
+
+
+def test_read_cleaning_trim_functions_lowercase():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "caggcgcccaccaccgtgccctccaacctgatggt"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 35                    # in future, should be '0'
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 35                    # in future, should be ?? @CTB
+
+    posns = x.find_spectral_error_positions(s, 1)
+    assert posns == []                    # in future, should do same
+
+
+def test_read_cleaning_trim_functions_N():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 0                     # in future, should be ??
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 0                     # in future, should be ??
+
+    with pytest.raises(ValueError):
+        posns = x.find_spectral_error_positions(s, 1)
+    # assert posns == []                    # in future, should return []
+
+
+def test_read_cleaning_trim_functions_bad_dna():
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Counttable(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    s = "CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC"
+    _, where = x.trim_on_abundance(s, 1)
+    assert where == 0                     # in future, should be ??
+
+    _, where = x.trim_below_abundance(s, 2)
+    assert where == 0                     # in future, should be ??
+
+    with pytest.raises(ValueError):
+        posns = x.find_spectral_error_positions(s, 1)
+    # assert posns == []                    # in future, should return [11]
+
+
+def test_read_cleaning_output_partitions():
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Nodegraph(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    kmer = 'caggcgcc'.upper()
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 1)
+
+    kmer = 'ACTGGGCG'
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 2)
+
+    kmer = 'CCGGCGTG'
+    x.add_tag(kmer)
+    x.set_partition_id(kmer, 3)
+
+    x.output_partitions(infile, savepath)
+
+    read_names = [read.name for read in ReadParser(savepath)]
+    print(read_names)
+    assert len(read_names) == 4
+
+    assert '895:1:1:1246:14654 1:N:0:NNNNN\t1' in read_names
+    assert '895:1:1:1248:9583 1:N:0:NNNNN\t2' in read_names
+    assert '895:1:1:1252:19493 1:N:0:NNNNN\t3' in read_names
+
+    assert 'lowercase_to_uppercase\t1' in read_names
+
+    assert 'n_in_read\t2' not in read_names
+    assert 'zy_in_read\t3' not in read_names
+
+
+def test_read_cleaning_trim_on_stoptags():
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in using "approved good" behavior w/cleaned_seq
+    x = Nodegraph(8, int(1e6), 4)
+    for read in ReadParser(infile):
+        x.consume(read.cleaned_seq)       # consume cleaned_seq
+
+    # add this as a stop tag
+    kmer = 'caggcgcc'.upper()
+    x.add_stop_tag(kmer)
+
+    kmer = 'ACTGGGCG'
+    x.add_stop_tag(kmer)
+
+    kmer = 'CCGGCGTG'
+    x.add_stop_tag(kmer)
+
+    _, pos = x.trim_on_stoptags('caggcgcccaccaccgtgccctccaacctgatggt')
+    assert pos == 6                       # should be ?? in future
+
+    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
+    assert pos == 0                       # should be 6 in future
+
+    _, pos = x.trim_on_stoptags('CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC')
+    assert pos == 0                       # should be 6 in future
+
+
+# vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
+# vim: set textwidth=79:

From 870678e45a25aca8f956df9f7a5062951ea54b11 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 21:00:47 -0800
Subject: [PATCH 10/32] split tests out to test_sequence_validation


From b2b22d75af604d390297ca6cfbf5c0727efceefa Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 21:11:56 -0800
Subject: [PATCH 11/32] parameterized with tabletype

---
 tests/test_sequence_validation.py | 43 +++++++++++++++++++------------
 1 file changed, 27 insertions(+), 16 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 8c062613a6..6cc2e326b8 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -37,6 +37,8 @@
 # Tests for the ReadParser and Read classes.
 from __future__ import print_function
 from __future__ import absolute_import
+from khmer import _Countgraph, _Counttable, _SmallCountgraph, _SmallCounttable
+from khmer import _Nodegraph, _Nodetable
 from khmer import ReadParser, Counttable, Nodegraph
 from screed import Record
 from . import khmer_tst_utils as utils
@@ -44,10 +46,19 @@
 from functools import reduce  # pylint: disable=redefined-builtin
 
 
-def test_read_cleaning_consume_seqfile():
+PRIMES_1m = [1000003, 1009837]
+
+
+# all the table types!
+@pytest.fixture(params=[_Countgraph, _Counttable, _SmallCountgraph,
+                        _SmallCounttable, _Nodegraph, _Nodetable])
+def tabletype(request):
+    return request.param
+
+def test_read_cleaning_consume_seqfile(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = Counttable(15, int(1e6), 4)
+    x = tabletype(15, PRIMES_1m)
     x.consume_seqfile(infile)
 
     # the relevant read will automatically get uppercased => abundance of 2
@@ -63,10 +74,10 @@ def test_read_cleaning_consume_seqfile():
     assert x.get(kmer) == 1               # this should be 2 in the future
 
 
-def test_read_cleaning_consume_read_by_read():
+def test_read_cleaning_consume_read_by_read(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = Counttable(15, int(1e6), 4)
+    x = tabletype(15, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.sequence)          # consume raw sequence
 
@@ -86,10 +97,10 @@ def test_read_cleaning_consume_read_by_read():
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_consume_read_by_read_cleaned_seq():
+def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = Counttable(15, int(1e6), 4)
+    x = tabletype(15, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -106,11 +117,11 @@ def test_read_cleaning_consume_read_by_read_cleaned_seq():
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_abundance_distribution():
+def test_read_cleaning_abundance_distribution(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = Counttable(15, int(1e6), 4)
-    y = Nodegraph(15, int(1e6), 4)
+    x = tabletype(15, PRIMES_1m)
+    y = _Nodegraph(15, PRIMES_1m)
 
     x.consume_seqfile(infile)
 
@@ -119,11 +130,11 @@ def test_read_cleaning_abundance_distribution():
     assert dist[2] == 42
 
 
-def test_read_cleaning_trim_functions_lowercase():
+def test_read_cleaning_trim_functions_lowercase(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
+    x = tabletype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -138,11 +149,11 @@ def test_read_cleaning_trim_functions_lowercase():
     assert posns == []                    # in future, should do same
 
 
-def test_read_cleaning_trim_functions_N():
+def test_read_cleaning_trim_functions_N(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
+    x = tabletype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -158,11 +169,11 @@ def test_read_cleaning_trim_functions_N():
     # assert posns == []                    # in future, should return []
 
 
-def test_read_cleaning_trim_functions_bad_dna():
+def test_read_cleaning_trim_functions_bad_dna(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = Counttable(8, int(1e6), 4)
+    x = tabletype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -183,7 +194,7 @@ def test_read_cleaning_output_partitions():
     savepath = utils.get_temp_filename('foo')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = Nodegraph(8, int(1e6), 4)
+    x = _Nodegraph(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 

From 12b88a5fa027f839062179dd907e70a39c962943 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Fri, 24 Feb 2017 21:15:36 -0800
Subject: [PATCH 12/32] add exceptions

---
 tests/test_sequence_validation.py | 12 ++++++++++++
 1 file changed, 12 insertions(+)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 6cc2e326b8..337f83d253 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -58,6 +58,9 @@ def tabletype(request):
 def test_read_cleaning_consume_seqfile(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
+    if tabletype == _Nodegraph or tabletype == _Nodetable:
+        return
+
     x = tabletype(15, PRIMES_1m)
     x.consume_seqfile(infile)
 
@@ -77,6 +80,9 @@ def test_read_cleaning_consume_seqfile(tabletype):
 def test_read_cleaning_consume_read_by_read(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
+    if tabletype == _Nodegraph or tabletype == _Nodetable:
+        return
+
     x = tabletype(15, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.sequence)          # consume raw sequence
@@ -100,6 +106,9 @@ def test_read_cleaning_consume_read_by_read(tabletype):
 def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
+    if tabletype == _Nodegraph or tabletype == _Nodetable:
+        return
+
     x = tabletype(15, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
@@ -120,6 +129,9 @@ def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype):
 def test_read_cleaning_abundance_distribution(tabletype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
+    if tabletype == _Nodegraph or tabletype == _Nodetable:
+        return
+
     x = tabletype(15, PRIMES_1m)
     y = _Nodegraph(15, PRIMES_1m)
 

From d303d46627cc3a9ed4e0c1ee6cd23b1d00b2b673 Mon Sep 17 00:00:00 2001
From: Tim Head <betatim@gmail.com>
Date: Tue, 28 Feb 2017 12:01:20 +0100
Subject: [PATCH 13/32] Add a fixture for ReadParser use

With the fixture we can explicitly close all the ReadParser which
might help with the too many open files error on OSX Travis
---
 tests/test_sequence_validation.py | 44 ++++++++++++++-----------------
 1 file changed, 20 insertions(+), 24 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 337f83d253..8e1e48973e 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -39,11 +39,9 @@
 from __future__ import absolute_import
 from khmer import _Countgraph, _Counttable, _SmallCountgraph, _SmallCounttable
 from khmer import _Nodegraph, _Nodetable
-from khmer import ReadParser, Counttable, Nodegraph
-from screed import Record
+from khmer import ReadParser, Nodegraph
 from . import khmer_tst_utils as utils
 import pytest
-from functools import reduce  # pylint: disable=redefined-builtin
 
 
 PRIMES_1m = [1000003, 1009837]
@@ -55,9 +53,17 @@
 def tabletype(request):
     return request.param
 
-def test_read_cleaning_consume_seqfile(tabletype):
+
+@pytest.fixture
+def reads():
     infile = utils.get_test_data('valid-read-testing.fq')
+    reads = ReadParser(infile)
+    yield reads
+    reads.close()
+
 
+def test_read_cleaning_consume_seqfile(tabletype):
+    infile = utils.get_test_data('valid-read-testing.fq')
     if tabletype == _Nodegraph or tabletype == _Nodetable:
         return
 
@@ -77,14 +83,12 @@ def test_read_cleaning_consume_seqfile(tabletype):
     assert x.get(kmer) == 1               # this should be 2 in the future
 
 
-def test_read_cleaning_consume_read_by_read(tabletype):
-    infile = utils.get_test_data('valid-read-testing.fq')
-
+def test_read_cleaning_consume_read_by_read(tabletype, reads):
     if tabletype == _Nodegraph or tabletype == _Nodetable:
         return
 
     x = tabletype(15, PRIMES_1m)
-    for read in ReadParser(infile):
+    for read in reads:
         x.consume(read.sequence)          # consume raw sequence
 
     # the relevant read will be entirely ignored
@@ -103,14 +107,12 @@ def test_read_cleaning_consume_read_by_read(tabletype):
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype):
-    infile = utils.get_test_data('valid-read-testing.fq')
-
+def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype, reads):
     if tabletype == _Nodegraph or tabletype == _Nodetable:
         return
 
     x = tabletype(15, PRIMES_1m)
-    for read in ReadParser(infile):
+    for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
     # the relevant read will be cleaned & loaded
@@ -142,12 +144,10 @@ def test_read_cleaning_abundance_distribution(tabletype):
     assert dist[2] == 42
 
 
-def test_read_cleaning_trim_functions_lowercase(tabletype):
-    infile = utils.get_test_data('valid-read-testing.fq')
-
+def test_read_cleaning_trim_functions_lowercase(tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
     x = tabletype(8, PRIMES_1m)
-    for read in ReadParser(infile):
+    for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
     s = "caggcgcccaccaccgtgccctccaacctgatggt"
@@ -161,12 +161,10 @@ def test_read_cleaning_trim_functions_lowercase(tabletype):
     assert posns == []                    # in future, should do same
 
 
-def test_read_cleaning_trim_functions_N(tabletype):
-    infile = utils.get_test_data('valid-read-testing.fq')
-
+def test_read_cleaning_trim_functions_N(tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
     x = tabletype(8, PRIMES_1m)
-    for read in ReadParser(infile):
+    for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
     s = "ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC"
@@ -181,12 +179,10 @@ def test_read_cleaning_trim_functions_N(tabletype):
     # assert posns == []                    # in future, should return []
 
 
-def test_read_cleaning_trim_functions_bad_dna(tabletype):
-    infile = utils.get_test_data('valid-read-testing.fq')
-
+def test_read_cleaning_trim_functions_bad_dna(tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
     x = tabletype(8, PRIMES_1m)
-    for read in ReadParser(infile):
+    for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
     s = "CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC"

From 08d2f28f55256dbf7e25c4fee5905855e8517e33 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 19:27:36 -0600
Subject: [PATCH 14/32] fix setup.py for offline operation

---
 setup.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/setup.py b/setup.py
index 2c11f4d8b1..7fc8d91c8a 100755
--- a/setup.py
+++ b/setup.py
@@ -227,7 +227,7 @@ def check_for_openmp():
         "packages": ['khmer', 'khmer.tests', 'oxli'],
         "package_dir": {'khmer.tests': 'tests'},
         "install_requires": ['screed >= 0.9', 'bz2file'],
-        "setup_requires": ["pytest-runner>=2.0,<3dev"],
+#        "setup_requires": ["pytest-runner>=2.0,<3dev"],
         "extras_require": {':python_version=="2.6"': ['argparse>=1.2.1'],
                            'docs': ['sphinx', 'sphinxcontrib-autoprogram'],
                            'tests': ['pytest>=2.9'],

From 29ed27596df47c9f2ffcf4473dfe0fc7b06b9a4d Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 19:35:35 -0600
Subject: [PATCH 15/32] fix pytest fixture problem on my laptop

---
 tests/test_sequence_validation.py | 8 ++++++--
 1 file changed, 6 insertions(+), 2 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 8e1e48973e..e3e6bb3f85 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -58,8 +58,12 @@ def tabletype(request):
 def reads():
     infile = utils.get_test_data('valid-read-testing.fq')
     reads = ReadParser(infile)
-    yield reads
-    reads.close()
+    try:
+        return reads
+    finally:
+        reads.close()
+#    yield reads
+#    reads.close()
 
 
 def test_read_cleaning_consume_seqfile(tabletype):

From 18d8577b248f9cd2630e2bc41cfb292abdb558a4 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 19:45:57 -0600
Subject: [PATCH 16/32] introduce graphtype fixture

---
 tests/test_sequence_validation.py | 8 +++++++-
 1 file changed, 7 insertions(+), 1 deletion(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index e3e6bb3f85..a33bf133ad 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -54,6 +54,12 @@ def tabletype(request):
     return request.param
 
 
+# all the graph types!
+@pytest.fixture(params=[_Countgraph, _Nodegraph])
+def graphtype(request):
+    return request.param
+
+
 @pytest.fixture
 def reads():
     infile = utils.get_test_data('valid-read-testing.fq')
@@ -238,7 +244,7 @@ def test_read_cleaning_output_partitions():
     assert 'zy_in_read\t3' not in read_names
 
 
-def test_read_cleaning_trim_on_stoptags():
+def test_read_cleaning_trim_on_stoptags(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
     savepath = utils.get_temp_filename('foo')
 

From 4c9c63b3cab51ea8594e23960bed9d32ec58a0ab Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 19:51:17 -0600
Subject: [PATCH 17/32] check the number of tags created by
 consume_fasta_and_tag

---
 tests/test_sequence_validation.py | 15 +++++++++++++--
 1 file changed, 13 insertions(+), 2 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index a33bf133ad..2cd8340bf6 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -207,7 +207,7 @@ def test_read_cleaning_trim_functions_bad_dna(tabletype, reads):
     # assert posns == []                    # in future, should return [11]
 
 
-def test_read_cleaning_output_partitions():
+def test_read_cleaning_output_partitions(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
     savepath = utils.get_temp_filename('foo')
 
@@ -249,7 +249,7 @@ def test_read_cleaning_trim_on_stoptags(graphtype):
     savepath = utils.get_temp_filename('foo')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = Nodegraph(8, int(1e6), 4)
+    x = graphtype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -273,5 +273,16 @@ def test_read_cleaning_trim_on_stoptags(graphtype):
     assert pos == 0                       # should be 6 in future
 
 
+def test_consume_seqfile_and_tag(graphtype):
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in consume_and_tag
+    x = graphtype(8, PRIMES_1m)
+    x.consume_seqfile_and_tag(infile)
+    _, n_tags = x.count_partitions()
+    assert n_tags == 4                    # total # of tags
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 5e01a81f1f3edc487fa5030f7ba28b10965c4493 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 20:03:34 -0600
Subject: [PATCH 18/32] add partition IDs to valid-dna testing fq

---
 tests/test-data/valid-read-testing.fq | 16 ++++++++--------
 tests/test_sequence_validation.py     | 25 +++++++++++++++++++------
 2 files changed, 27 insertions(+), 14 deletions(-)

diff --git a/tests/test-data/valid-read-testing.fq b/tests/test-data/valid-read-testing.fq
index e52c058709..fc0b85ea41 100644
--- a/tests/test-data/valid-read-testing.fq
+++ b/tests/test-data/valid-read-testing.fq
@@ -1,32 +1,32 @@
-@895:1:1:1246:14654 1:N:0:NNNNN
+@895:1:1:1246:14654 1:N:0:NNNNN	1
 CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT
 +
 ][aaX__aa[`ZUZ[NONNFNNNNNO_____^RQ_
-@895:1:1:1248:9583 1:N:0:NNNNN
+@895:1:1:1248:9583 1:N:0:NNNNN	2
 ACTGGGCGTAGACGGTGTCCTCATCGGCACCAGC
 +
 \UJUWSSV[JQQWNP]]SZ]ZWU^]ZX][^TXR`
-@895:1:1:1252:19493 1:N:0:NNNNN
+@895:1:1:1252:19493 1:N:0:NNNNN	3
 CCGGCGTGGTTGGTGAGGTCACTGAGCTTCATGTC
 +
 OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
-@895:1:1:1255:18861 1:N:0:NNNNN
+@895:1:1:1255:18861 1:N:0:NNNNN	4
 ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
 +
 bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
-@lowercase_to_uppercase
+@lowercase_to_uppercase	5
 caggcgcccaccaccgtgccctccaacctgatggt
 +
 ][aaX__aa[`ZUZ[NONNFNNNNNO_____^RQ_
-@n_in_read
+@n_in_read	6
 ACTGGGCGTAGNCGGTGTCCTCATCGGCACCAGC
 +
 \UJUWSSV[JQQWNP]]SZ]ZWU^]ZX][^TXR`
-@zy_in_read
+@zy_in_read	7
 CCGGCGTGGTTZZYAGGTCACTGAGCTTCATGTC
 +
 OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
-@895:1:1:1255:18861 1:N:0:NNNNN
+@895:1:1:1255:18861 1:N:0:NNNNN	8
 ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
 +
 bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 2cd8340bf6..d650facb00 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -234,14 +234,15 @@ def test_read_cleaning_output_partitions(graphtype):
     print(read_names)
     assert len(read_names) == 4
 
-    assert '895:1:1:1246:14654 1:N:0:NNNNN\t1' in read_names
-    assert '895:1:1:1248:9583 1:N:0:NNNNN\t2' in read_names
-    assert '895:1:1:1252:19493 1:N:0:NNNNN\t3' in read_names
+    print(read_names)
+    assert '895:1:1:1246:14654 1:N:0:NNNNN\t1\t1' in read_names
+    assert '895:1:1:1248:9583 1:N:0:NNNNN\t2\t2' in read_names
+    assert '895:1:1:1252:19493 1:N:0:NNNNN\t3\t3' in read_names
 
-    assert 'lowercase_to_uppercase\t1' in read_names
+    assert 'lowercase_to_uppercase\t5\t1' in read_names
 
-    assert 'n_in_read\t2' not in read_names
-    assert 'zy_in_read\t3' not in read_names
+    assert 'n_in_read\t6\t2' not in read_names
+    assert 'zy_in_read\t7\t3' not in read_names
 
 
 def test_read_cleaning_trim_on_stoptags(graphtype):
@@ -284,5 +285,17 @@ def test_consume_seqfile_and_tag(graphtype):
     assert n_tags == 4                    # total # of tags
 
 
+def test_consume_partitioned_seqfile(graphtype):
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in consume_and_tag
+    x = graphtype(8, PRIMES_1m)
+    x.consume_partitioned_fasta(infile)
+    n_partitions, n_tags = x.count_partitions()
+    assert n_partitions == 4
+    assert n_tags == 0
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 85b8fa22e70da6e6941c18eaa46b55049d5e7c6d Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 20:07:58 -0600
Subject: [PATCH 19/32] add test for output_partitions

---
 tests/test_sequence_validation.py | 26 +++++++++++++++++++++++---
 1 file changed, 23 insertions(+), 3 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index d650facb00..26218224ec 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -247,7 +247,6 @@ def test_read_cleaning_output_partitions(graphtype):
 
 def test_read_cleaning_trim_on_stoptags(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
-    savepath = utils.get_temp_filename('foo')
 
     # read this in using "approved good" behavior w/cleaned_seq
     x = graphtype(8, PRIMES_1m)
@@ -276,7 +275,6 @@ def test_read_cleaning_trim_on_stoptags(graphtype):
 
 def test_consume_seqfile_and_tag(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
-    savepath = utils.get_temp_filename('foo')
 
     # read this in consume_and_tag
     x = graphtype(8, PRIMES_1m)
@@ -287,7 +285,6 @@ def test_consume_seqfile_and_tag(graphtype):
 
 def test_consume_partitioned_seqfile(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
-    savepath = utils.get_temp_filename('foo')
 
     # read this in consume_and_tag
     x = graphtype(8, PRIMES_1m)
@@ -297,5 +294,28 @@ def test_consume_partitioned_seqfile(graphtype):
     assert n_tags == 0
 
 
+def test_output_partitioned_file(graphtype):
+    infile = utils.get_test_data('valid-read-testing.fq')
+    savepath = utils.get_temp_filename('foo')
+
+    # read this in consume_and_tag
+    x = graphtype(8, PRIMES_1m)
+    x.consume_partitioned_fasta(infile)
+    x.output_partitions(infile, savepath)
+
+    read_names = [read.name for read in ReadParser(savepath)]
+    read_names = set(read_names)
+
+    good_names = ['895:1:1:1246:14654 1:N:0:NNNNN\t1\t5',
+                  '895:1:1:1248:9583 1:N:0:NNNNN\t2\t2',
+                  '895:1:1:1252:19493 1:N:0:NNNNN\t3\t3',
+                  '895:1:1:1255:18861 1:N:0:NNNNN\t4\t8',
+                  'lowercase_to_uppercase\t5\t5',
+                  '895:1:1:1255:18861 1:N:0:NNNNN\t8\t8']
+    good_names = set(good_names)
+
+    assert good_names == read_names
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From f61e37ca582962030d451fc76b1f7c617399441e Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 20:21:23 -0600
Subject: [PATCH 20/32] increase ksize to 15 for partition reading tests

---
 tests/test_sequence_validation.py | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 26218224ec..ecb14dd856 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -287,7 +287,7 @@ def test_consume_partitioned_seqfile(graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in consume_and_tag
-    x = graphtype(8, PRIMES_1m)
+    x = graphtype(15, PRIMES_1m)
     x.consume_partitioned_fasta(infile)
     n_partitions, n_tags = x.count_partitions()
     assert n_partitions == 4
@@ -299,7 +299,7 @@ def test_output_partitioned_file(graphtype):
     savepath = utils.get_temp_filename('foo')
 
     # read this in consume_and_tag
-    x = graphtype(8, PRIMES_1m)
+    x = graphtype(15, PRIMES_1m)
     x.consume_partitioned_fasta(infile)
     x.output_partitions(infile, savepath)
 

From b1519a3b07f0d903855860cad1ddb746d7ec19ec Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 20:31:37 -0600
Subject: [PATCH 21/32] add tests for labelhash

---
 tests/test_sequence_validation.py | 24 +++++++++++++++++++++++-
 1 file changed, 23 insertions(+), 1 deletion(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index ecb14dd856..4d9633ce67 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -39,7 +39,7 @@
 from __future__ import absolute_import
 from khmer import _Countgraph, _Counttable, _SmallCountgraph, _SmallCounttable
 from khmer import _Nodegraph, _Nodetable
-from khmer import ReadParser, Nodegraph
+from khmer import ReadParser, Nodegraph, _GraphLabels
 from . import khmer_tst_utils as utils
 import pytest
 
@@ -317,5 +317,27 @@ def test_output_partitioned_file(graphtype):
     assert good_names == read_names
 
 
+def test_consume_seqfile_and_tag_with_labels(graphtype):
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in consume_and_tag
+    graph = graphtype(15, PRIMES_1m)
+    x = _GraphLabels(graph)
+    x.consume_seqfile_and_tag_with_labels(infile)
+
+    assert x.n_labels() == 6
+
+
+def test_consume_partitioned_seqfile_and_label(graphtype):
+    infile = utils.get_test_data('valid-read-testing.fq')
+
+    # read this in consume_and_tag
+    graph = graphtype(15, PRIMES_1m)
+    x = _GraphLabels(graph)
+    x.consume_partitioned_fasta_and_tag_with_labels(infile)
+
+    assert x.n_labels() == 6
+
+
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 08eca98bc3aa43cedfd9e9b9d5f1d512d7359d95 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 23:07:45 -0600
Subject: [PATCH 22/32] uncomment pytest-runner req

---
 setup.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/setup.py b/setup.py
index 7fc8d91c8a..2c11f4d8b1 100755
--- a/setup.py
+++ b/setup.py
@@ -227,7 +227,7 @@ def check_for_openmp():
         "packages": ['khmer', 'khmer.tests', 'oxli'],
         "package_dir": {'khmer.tests': 'tests'},
         "install_requires": ['screed >= 0.9', 'bz2file'],
-#        "setup_requires": ["pytest-runner>=2.0,<3dev"],
+        "setup_requires": ["pytest-runner>=2.0,<3dev"],
         "extras_require": {':python_version=="2.6"': ['argparse>=1.2.1'],
                            'docs': ['sphinx', 'sphinxcontrib-autoprogram'],
                            'tests': ['pytest>=2.9'],

From caa85b4ab02e4cc0b396d1a77773d5190ed419e4 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 23:09:47 -0600
Subject: [PATCH 23/32] remove unnecessary imports

---
 tests/test_read_parsers.py | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index a919bb5a00..4834cdcd78 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -38,7 +38,7 @@
 from __future__ import print_function
 from __future__ import absolute_import
 from khmer import Read
-from khmer import ReadParser, Counttable, Nodegraph
+from khmer import ReadParser
 from screed import Record
 from . import khmer_tst_utils as utils
 import pytest

From bf94884807d8b23ce4d9dff05f0e21dde96a2732 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 23:10:18 -0600
Subject: [PATCH 24/32] remove line spacing

---
 tests/test_read_parsers.py | 1 -
 1 file changed, 1 deletion(-)

diff --git a/tests/test_read_parsers.py b/tests/test_read_parsers.py
index 4834cdcd78..22cdf32ad7 100644
--- a/tests/test_read_parsers.py
+++ b/tests/test_read_parsers.py
@@ -483,6 +483,5 @@ def test_clean_seq():
         clean = read.sequence.upper().replace("N", "A")
         assert clean == read.cleaned_seq
 
-
 # vim: set filetype=python tabstop=4 softtabstop=4 shiftwidth=4 expandtab:
 # vim: set textwidth=79:

From 15bc92c00614293c95f3390740a4270883f3385f Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sat, 18 Mar 2017 22:18:32 -0700
Subject: [PATCH 25/32] distinguished tabletype from countingtype

---
 tests/test_sequence_validation.py | 34 ++++++++++++++-----------------
 1 file changed, 15 insertions(+), 19 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 4d9633ce67..96d6ee30df 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -54,6 +54,13 @@ def tabletype(request):
     return request.param
 
 
+# all the counting types!
+@pytest.fixture(params=[_Countgraph, _Counttable, _SmallCountgraph,
+                        _SmallCounttable])
+def countingtype(request):
+    return request.param
+
+
 # all the graph types!
 @pytest.fixture(params=[_Countgraph, _Nodegraph])
 def graphtype(request):
@@ -72,12 +79,10 @@ def reads():
 #    reads.close()
 
 
-def test_read_cleaning_consume_seqfile(tabletype):
+def test_read_cleaning_consume_seqfile(countingtype):
     infile = utils.get_test_data('valid-read-testing.fq')
-    if tabletype == _Nodegraph or tabletype == _Nodetable:
-        return
 
-    x = tabletype(15, PRIMES_1m)
+    x = countingtype(15, PRIMES_1m)
     x.consume_seqfile(infile)
 
     # the relevant read will automatically get uppercased => abundance of 2
@@ -93,11 +98,8 @@ def test_read_cleaning_consume_seqfile(tabletype):
     assert x.get(kmer) == 1               # this should be 2 in the future
 
 
-def test_read_cleaning_consume_read_by_read(tabletype, reads):
-    if tabletype == _Nodegraph or tabletype == _Nodetable:
-        return
-
-    x = tabletype(15, PRIMES_1m)
+def test_read_cleaning_consume_read_by_read(countingtype, reads):
+    x = countingtype(15, PRIMES_1m)
     for read in reads:
         x.consume(read.sequence)          # consume raw sequence
 
@@ -117,11 +119,8 @@ def test_read_cleaning_consume_read_by_read(tabletype, reads):
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype, reads):
-    if tabletype == _Nodegraph or tabletype == _Nodetable:
-        return
-
-    x = tabletype(15, PRIMES_1m)
+def test_read_cleaning_consume_read_by_read_cleaned_seq(countingtype, reads):
+    x = countingtype(15, PRIMES_1m)
     for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -138,13 +137,10 @@ def test_read_cleaning_consume_read_by_read_cleaned_seq(tabletype, reads):
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_abundance_distribution(tabletype):
+def test_read_cleaning_abundance_distribution(countingtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    if tabletype == _Nodegraph or tabletype == _Nodetable:
-        return
-
-    x = tabletype(15, PRIMES_1m)
+    x = countingtype(15, PRIMES_1m)
     y = _Nodegraph(15, PRIMES_1m)
 
     x.consume_seqfile(infile)

From 6304e2f81cdc5e516ce6a03fdfbd7e45eedb074c Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Mar 2017 07:18:58 -0700
Subject: [PATCH 26/32] remove commented-out code

---
 tests/test_sequence_validation.py | 2 --
 1 file changed, 2 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 96d6ee30df..bd6e797ebd 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -75,8 +75,6 @@ def reads():
         return reads
     finally:
         reads.close()
-#    yield reads
-#    reads.close()
 
 
 def test_read_cleaning_consume_seqfile(countingtype):

From d2a20d8f7f335113cc64361fd27091e4c70c2dbe Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Mar 2017 07:20:56 -0700
Subject: [PATCH 27/32] add a test where bad DNA is at beginning of string

---
 tests/test-data/valid-read-testing.fq | 4 ++++
 1 file changed, 4 insertions(+)

diff --git a/tests/test-data/valid-read-testing.fq b/tests/test-data/valid-read-testing.fq
index fc0b85ea41..91a1ff76f8 100644
--- a/tests/test-data/valid-read-testing.fq
+++ b/tests/test-data/valid-read-testing.fq
@@ -30,3 +30,7 @@ OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
 ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
 +
 bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
+@bad_dna_in_beginning
+YGAGCTGAGAGCTGAGAGCTGA
++
+bbbbbbbbbbbbbbbbbbbbbb

From 86e70813f120049d5fdc75ffac9a1788df6d6bf6 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Mar 2017 07:31:09 -0700
Subject: [PATCH 28/32] write test for consume_partitioned_fasta on
 unpartitioned file

---
 lib/read_parsers.hh     | 8 +++++---
 tests/test_nodegraph.py | 8 ++++++++
 2 files changed, 13 insertions(+), 3 deletions(-)

diff --git a/lib/read_parsers.hh b/lib/read_parsers.hh
index 2773b1ff67..6d8fcd2408 100644
--- a/lib/read_parsers.hh
+++ b/lib/read_parsers.hh
@@ -208,9 +208,11 @@ inline PartitionID _parse_partition_id(std::string name)
     if (*s == '\t') {
         p = (PartitionID) atoi(s + 1);
     } else {
-        std::cerr << "consume_partitioned_fasta barfed on read "
-                  << name << "\n";
-        throw khmer_exception();
+        std::string err;
+        err = "consume_partitioned_fasta cannot find partition ID for read";
+        err += name;
+
+        throw khmer_value_exception(err);
     }
 
     return p;
diff --git a/tests/test_nodegraph.py b/tests/test_nodegraph.py
index 204d9a1b4b..774c2e962f 100644
--- a/tests/test_nodegraph.py
+++ b/tests/test_nodegraph.py
@@ -337,6 +337,14 @@ def test_load_partitioned():
     assert nodegraph.get(third_s)
 
 
+def test_consume_partitioned_fail():
+    inpfile = utils.get_test_data('test-reads.fa')
+    nodegraph = khmer._Nodegraph(32, [1])
+
+    with pytest.raises(ValueError):
+        nodegraph.consume_partitioned_fasta(inpfile)
+
+
 def test_count_within_radius_simple():
     inpfile = utils.get_test_data('all-A.fa')
     nodegraph = khmer._Nodegraph(4, [3, 5])

From f47a36096596e76363b81914347a490e8b2442d2 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Mar 2017 07:37:32 -0700
Subject: [PATCH 29/32] add space in reporting

---
 lib/read_parsers.hh | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/lib/read_parsers.hh b/lib/read_parsers.hh
index 6d8fcd2408..04a9bdbfa9 100644
--- a/lib/read_parsers.hh
+++ b/lib/read_parsers.hh
@@ -209,7 +209,7 @@ inline PartitionID _parse_partition_id(std::string name)
         p = (PartitionID) atoi(s + 1);
     } else {
         std::string err;
-        err = "consume_partitioned_fasta cannot find partition ID for read";
+        err = "consume_partitioned_fasta cannot find partition ID for read ";
         err += name;
 
         throw khmer_value_exception(err);

From 7e9c7a0b0cab36a3a4d634126692ab0258cd41b3 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Sun, 19 Mar 2017 07:44:24 -0700
Subject: [PATCH 30/32] add partition ID to new 'bad' sequence

---
 tests/test-data/valid-read-testing.fq | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/tests/test-data/valid-read-testing.fq b/tests/test-data/valid-read-testing.fq
index 91a1ff76f8..f2b8984e5a 100644
--- a/tests/test-data/valid-read-testing.fq
+++ b/tests/test-data/valid-read-testing.fq
@@ -30,7 +30,7 @@ OOOKONNNNN__`R]O[TGTRSY[IUZ]]]__X__
 ACGACGAGAAGCTGATCTACCGCGCCGAGCGCATC
 +
 bb_^^bb_XTbbbbbb_bab]KTITZQTZ]ZYT^^
-@bad_dna_in_beginning
+@bad_dna_in_beginning	9
 YGAGCTGAGAGCTGAGAGCTGA
 +
 bbbbbbbbbbbbbbbbbbbbbb

From e419a7bf203fb0135d92e319042a804d04b1c12f Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Mon, 20 Mar 2017 06:04:34 -0700
Subject: [PATCH 31/32] address review comments <- minor changes

---
 tests/test_sequence_validation.py | 69 +++++++++++++++----------------
 1 file changed, 33 insertions(+), 36 deletions(-)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index bd6e797ebd..37b2ccc4f1 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -50,37 +50,34 @@
 # all the table types!
 @pytest.fixture(params=[_Countgraph, _Counttable, _SmallCountgraph,
                         _SmallCounttable, _Nodegraph, _Nodetable])
-def tabletype(request):
+def Tabletype(request):
     return request.param
 
 
 # all the counting types!
 @pytest.fixture(params=[_Countgraph, _Counttable, _SmallCountgraph,
                         _SmallCounttable])
-def countingtype(request):
+def Countingtype(request):
     return request.param
 
 
 # all the graph types!
 @pytest.fixture(params=[_Countgraph, _Nodegraph])
-def graphtype(request):
+def Graphtype(request):
     return request.param
 
 
-@pytest.fixture
+@pytest.yield_fixture
 def reads():
     infile = utils.get_test_data('valid-read-testing.fq')
     reads = ReadParser(infile)
-    try:
-        return reads
-    finally:
-        reads.close()
+    yield reads
 
 
-def test_read_cleaning_consume_seqfile(countingtype):
+def test_read_cleaning_consume_seqfile(Countingtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = countingtype(15, PRIMES_1m)
+    x = Countingtype(15, PRIMES_1m)
     x.consume_seqfile(infile)
 
     # the relevant read will automatically get uppercased => abundance of 2
@@ -96,8 +93,8 @@ def test_read_cleaning_consume_seqfile(countingtype):
     assert x.get(kmer) == 1               # this should be 2 in the future
 
 
-def test_read_cleaning_consume_read_by_read(countingtype, reads):
-    x = countingtype(15, PRIMES_1m)
+def test_read_cleaning_consume_read_by_read(Countingtype, reads):
+    x = Countingtype(15, PRIMES_1m)
     for read in reads:
         x.consume(read.sequence)          # consume raw sequence
 
@@ -117,8 +114,8 @@ def test_read_cleaning_consume_read_by_read(countingtype, reads):
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_consume_read_by_read_cleaned_seq(countingtype, reads):
-    x = countingtype(15, PRIMES_1m)
+def test_read_cleaning_consume_read_by_read_cleaned_seq(Countingtype, reads):
+    x = Countingtype(15, PRIMES_1m)
     for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -135,10 +132,10 @@ def test_read_cleaning_consume_read_by_read_cleaned_seq(countingtype, reads):
     assert x.get(kmer) == 2
 
 
-def test_read_cleaning_abundance_distribution(countingtype):
+def test_read_cleaning_abundance_distribution(Countingtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
-    x = countingtype(15, PRIMES_1m)
+    x = Countingtype(15, PRIMES_1m)
     y = _Nodegraph(15, PRIMES_1m)
 
     x.consume_seqfile(infile)
@@ -148,9 +145,9 @@ def test_read_cleaning_abundance_distribution(countingtype):
     assert dist[2] == 42
 
 
-def test_read_cleaning_trim_functions_lowercase(tabletype, reads):
+def test_read_cleaning_trim_functions_lowercase(Tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
-    x = tabletype(8, PRIMES_1m)
+    x = Tabletype(8, PRIMES_1m)
     for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -165,9 +162,9 @@ def test_read_cleaning_trim_functions_lowercase(tabletype, reads):
     assert posns == []                    # in future, should do same
 
 
-def test_read_cleaning_trim_functions_N(tabletype, reads):
+def test_read_cleaning_trim_functions_N(Tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
-    x = tabletype(8, PRIMES_1m)
+    x = Tabletype(8, PRIMES_1m)
     for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -183,9 +180,9 @@ def test_read_cleaning_trim_functions_N(tabletype, reads):
     # assert posns == []                    # in future, should return []
 
 
-def test_read_cleaning_trim_functions_bad_dna(tabletype, reads):
+def test_read_cleaning_trim_functions_bad_dna(Tabletype, reads):
     # read this in using "approved good" behavior w/cleaned_seq
-    x = tabletype(8, PRIMES_1m)
+    x = Tabletype(8, PRIMES_1m)
     for read in reads:
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -201,12 +198,12 @@ def test_read_cleaning_trim_functions_bad_dna(tabletype, reads):
     # assert posns == []                    # in future, should return [11]
 
 
-def test_read_cleaning_output_partitions(graphtype):
+def test_read_cleaning_output_partitions(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
     savepath = utils.get_temp_filename('foo')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = _Nodegraph(8, PRIMES_1m)
+    x = Graphtype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -239,11 +236,11 @@ def test_read_cleaning_output_partitions(graphtype):
     assert 'zy_in_read\t7\t3' not in read_names
 
 
-def test_read_cleaning_trim_on_stoptags(graphtype):
+def test_read_cleaning_trim_on_stoptags(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in using "approved good" behavior w/cleaned_seq
-    x = graphtype(8, PRIMES_1m)
+    x = Graphtype(8, PRIMES_1m)
     for read in ReadParser(infile):
         x.consume(read.cleaned_seq)       # consume cleaned_seq
 
@@ -267,33 +264,33 @@ def test_read_cleaning_trim_on_stoptags(graphtype):
     assert pos == 0                       # should be 6 in future
 
 
-def test_consume_seqfile_and_tag(graphtype):
+def test_consume_seqfile_and_tag(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in consume_and_tag
-    x = graphtype(8, PRIMES_1m)
+    x = Graphtype(8, PRIMES_1m)
     x.consume_seqfile_and_tag(infile)
     _, n_tags = x.count_partitions()
     assert n_tags == 4                    # total # of tags
 
 
-def test_consume_partitioned_seqfile(graphtype):
+def test_consume_partitioned_seqfile(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in consume_and_tag
-    x = graphtype(15, PRIMES_1m)
+    x = Graphtype(15, PRIMES_1m)
     x.consume_partitioned_fasta(infile)
     n_partitions, n_tags = x.count_partitions()
     assert n_partitions == 4
     assert n_tags == 0
 
 
-def test_output_partitioned_file(graphtype):
+def test_output_partitioned_file(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
     savepath = utils.get_temp_filename('foo')
 
     # read this in consume_and_tag
-    x = graphtype(15, PRIMES_1m)
+    x = Graphtype(15, PRIMES_1m)
     x.consume_partitioned_fasta(infile)
     x.output_partitions(infile, savepath)
 
@@ -311,22 +308,22 @@ def test_output_partitioned_file(graphtype):
     assert good_names == read_names
 
 
-def test_consume_seqfile_and_tag_with_labels(graphtype):
+def test_consume_seqfile_and_tag_with_labels(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in consume_and_tag
-    graph = graphtype(15, PRIMES_1m)
+    graph = Graphtype(15, PRIMES_1m)
     x = _GraphLabels(graph)
     x.consume_seqfile_and_tag_with_labels(infile)
 
     assert x.n_labels() == 6
 
 
-def test_consume_partitioned_seqfile_and_label(graphtype):
+def test_consume_partitioned_seqfile_and_label(Graphtype):
     infile = utils.get_test_data('valid-read-testing.fq')
 
     # read this in consume_and_tag
-    graph = graphtype(15, PRIMES_1m)
+    graph = Graphtype(15, PRIMES_1m)
     x = _GraphLabels(graph)
     x.consume_partitioned_fasta_and_tag_with_labels(infile)
 

From 3cb741bf6ec15fd762479a587ff573ceacb03ad0 Mon Sep 17 00:00:00 2001
From: "C. Titus Brown" <titus@idyll.org>
Date: Mon, 20 Mar 2017 06:26:44 -0700
Subject: [PATCH 32/32] re-added reads.close to yield_fixture

---
 tests/test_sequence_validation.py | 1 +
 1 file changed, 1 insertion(+)

diff --git a/tests/test_sequence_validation.py b/tests/test_sequence_validation.py
index 37b2ccc4f1..d3ac8af94e 100644
--- a/tests/test_sequence_validation.py
+++ b/tests/test_sequence_validation.py
@@ -72,6 +72,7 @@ def reads():
     infile = utils.get_test_data('valid-read-testing.fq')
     reads = ReadParser(infile)
     yield reads
+    reads.close()
 
 
 def test_read_cleaning_consume_seqfile(Countingtype):